Fur leader peptide (A8DYP9)
| Identification | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Name: | Fur leader peptide | ||||||||
| Synonyms: | Not Available | ||||||||
| Gene Name: | uof | ||||||||
| Enzyme Class: | Not Available | ||||||||
| Biological Properties | |||||||||
| General Function: | regulation of translation | ||||||||
| Specific Function: | Cotranscribed with fur, it is essential for fur translation. The fur ribosomal binding site (RBS) is occluded by the 5'-mRNA secondary structure, which is opened by uof translation. | ||||||||
| Cellular Location: | Not Available | ||||||||
| SMPDB Pathways: | Not Available | ||||||||
| KEGG Pathways: | Not Available | ||||||||
| Metabolites: |
| ||||||||
| GO Classification: |
| ||||||||
| Gene Properties | |||||||||
| Blattner: | Not Available | ||||||||
| Gene Orientation | Not Available | ||||||||
| Centisome Percentage: | Not Available | ||||||||
| Left Sequence End | Not Available | ||||||||
| Right Sequence End | Not Available | ||||||||
| Gene Sequence: | >87 atgatacgcattatctcaagagcaaattctgtcacttcttctaatgaagtgaaccgctta gtaacaggacagattccgcatgactga | ||||||||
| Protein Properties | |||||||||
| Pfam Domain Function: | Not Available | ||||||||
| Protein Residues: | 28 | ||||||||
| Protein Molecular Weight: | 3108 | ||||||||
| Protein Theoretical pI: | Not Available | ||||||||
| Signaling Regions: | Not Available | ||||||||
| Transmembrane Regions: | Not Available | ||||||||
| Protein Sequence: | >Fur leader peptide MIRIISRANSVTSSNEVNRLVTGQIPHD | ||||||||
| References | |||||||||
| External Links: |
| ||||||||
| General Reference: | Not Available | ||||||||