| Identification |
|---|
| Name: | Division inhibition protein DicB |
|---|
| Synonyms: | Not Available |
|---|
| Gene Name: | dicB |
|---|
| Enzyme Class: | Not Available |
|---|
| Biological Properties |
|---|
| General Function: | regulation of cell division |
|---|
| Specific Function: | Involved in cell division inhibition; this function can be repressed by DicA and DicC proteins as well as antitoxin CbeA (yeeU). |
|---|
| Cellular Location: | Not Available |
|---|
| SMPDB Pathways: | Not Available |
|---|
| KEGG Pathways: | Not Available |
|---|
| Metabolites: | |
|---|
| GO Classification: | | Function |
|---|
| cell cycle | | cell division | | regulation of cell division |
|
|---|
| Gene Properties |
|---|
| Blattner: | Not Available |
|---|
| Gene Orientation | Not Available |
|---|
| Centisome Percentage: | Not Available |
|---|
| Left Sequence End | Not Available |
|---|
| Right Sequence End | Not Available |
|---|
| Gene Sequence: | >189
atgaaaacgttattaccaaacgttaatacgtctgaaggttgttttgaaattggtgtcact
atcagtaacccagtatttactgaagatgccattaacaagagaaaacaagaacgggagcta
ttaaataaaatatgcattgtttcaatgctggctcgtttacgtctgatgccaaaaggatgt
gcacaatga |
|---|
| Protein Properties |
|---|
| Pfam Domain Function: | Not Available |
|---|
| Protein Residues: | 62 |
|---|
| Protein Molecular Weight: | 6964 |
|---|
| Protein Theoretical pI: | Not Available |
|---|
| Signaling Regions: | Not Available |
|---|
| Transmembrane Regions: | Not Available |
|---|
| Protein Sequence: | >Division inhibition protein DicB
MKTLLPNVNTSEGCFEIGVTISNPVFTEDAINKRKQERELLNKICIVSMLARLRLMPKGC
AQ |
|---|
| References |
|---|
| External Links: | |
|---|
| General Reference: | Not Available |
|---|
